The composition of the weight-reduction plan impacts many processes within the physique, together with physique weight and endocrine system. Now we have beforehand proven that dietary fats additionally impacts the immune system. Mice fed excessive fats weight-reduction plan wealthy in polyunsaturated fatty acids survive S. aureus an infection to a a lot higher extent than mice fed excessive fats weight-reduction plan wealthy in saturated fatty acids. Right here we current information concerning the dietary results on protein expression in spleen from mice fed three totally different diets, I) low fats/chow weight-reduction plan (LFD, n = 4), II) excessive fats weight-reduction plan wealthy in saturated fatty acids (HFD-S, n = 4) and III) excessive fats weight-reduction plan wealthy in polyunsaturated fatty acids (HFD-P, n = 4).
We carried out mass spectrophotometry based mostly quantitative proteomics evaluation of remoted spleen by implementing the isobaric tags for relative and absolute quantification (iTRAQ) method. Mass spectrometry information had been analyzed utilizing Proteome Discoverer 2.Four software program utilizing the search engine mascot towards Mus musculus in SwissProt. 924 proteins are recognized in all units (n = 4) for various dietary results taken for statistical evaluation utilizing Qlucore Omics Explorer software program. Solely 20 proteins had been discovered to be differentially expressed with a cut-off worth of false discovery price < 0.1 (q-value) when evaluating HFD-S and HFD-P however no differentially expressed proteins had been discovered when LFD was in contrast with HFD-P or HFD-S. The recognized proteins and statistical evaluation evaluating HFD-S and HFD-P diets can be found as a supplementary file S1. We recognized a subset of proteins that confirmed an inverse expression sample between two excessive fats diets. These differentially expressed proteins had been additional categorised by gene ontology for his or her position in organic processes and molecular features. Mass spectrometry uncooked information are additionally out there by way of ProteomeXchange with identifier PXD020365.
Prime-down mass spectrometry (MS)-based proteomics permits a complete evaluation of proteoforms with molecular specificity to attain a proteome-wide understanding of protein features. Nonetheless, the shortage of a common software program for top-down proteomics is changing into more and more acknowledged as a significant barrier particularly for newcomers. Right here we develop MASH Explorer, a common, complete, and user-friendly software program surroundings for top-down proteomics. MASH Explorer integrates a number of spectral deconvolution and database looking out algorithms right into a single, common platform which might course of top-down proteomics information from varied vendor codecs, for the primary time. It addresses the pressing want within the quickly rising top-down proteomics neighborhood and is freely out there to all customers worldwide. With the vital want and large help from the neighborhood, we envision this MASH Explorer software program package deal will play an integral position in advancing top-down proteomics to understand its full potential for biomedical analysis.
Theoretical minimal RNA rings mimick molecular evolution earlier than tRNA-mediated translation: codon-amino acid affinities improve from early to late RNA rings
Nucleotide affinities for noncovalent interactions with amino acids produce associations between mRNAs and cognate peptides, doubtlessly regulating ribosomal translation. Correlations between nucleotide affinities and residue hydrophobicity are explored for 25 theoretical minimal RNA rings, 22 nucleotide-long RNAs designed in silico to code for every amino acid as soon as after three translation rounds, and forming stem-loop hairpins. This design presumably mimicks life’s first RNAs. RNA rings resemble consensual tRNAs, suggesting proto-tRNA operate, predicted anticodon and cognate amino acid. The 25 RNA rings and their presumed evolutionary order, deduced from the genetic code integration order of the amino acid cognate to their predicted anticodon, produces noteworthy associations with a number of historical properties of the cell’s translational equipment. Right here we use this method to discover the evolution of codon affinity-residue hydrophobicity correlations, assuming these replicate pre-tRNA and pre-ribosomal translations.
This speculation expects that correlations lower with genetic code inclusion orders of RNA ring cognates. RNA ring associations between nucleotide affinities and residue hydrophobicities resemble these from fashionable pure genes/proteins. Affiliation strengths lower with genetic code inclusion ranks of proto-tRNA cognate amino acids. In silico design of minimal RNA rings did not account for affinities between RNA and peptides coded by these RNAs. But, interactions between RNA rings and translated cognate peptides resemble fashionable pure genes.
This property is strongest for historical RNA rings, weakest for current RNA rings, spanning a interval throughout which fashionable tRNA- and ribosome-based translation presumably advanced. Outcomes point out that translation missing tRNA-like adaptors based mostly on codon-amino acid affinities and the genetic code pre-existed tRNA-mediated translation. Theoretical minimal RNA rings seem legitimate prebiotic peptide-RNA world fashions for the transition between pre-tRNA- and tRNA-mediated translations.
[Correlation between hyponatremia and the severity of coronavirus disease 2019]
Among the many 12 sufferers with COVID-19, there have been eight males and Four females with the imply age of (38.0±16.3) years previous, most of them had been admitted to the hospital with cough and/or fever. All sufferers had a constructive nucleic acid take a look at for 2019 novel coronavirus (2019-nCoV), and had been discharged after medical therapy with oxygen remedy, antiviral, antibacterial, anti-inflammatory, and dietary help. All sufferers had been of peculiar kind once they had been admitted to the hospital.
 ELISA Kit) Human Granulysin (GNLY) ELISA Kit |
|
RD-GNLY-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Granulysin (GNLY) ELISA Kit |
|
RD-GNLY-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
 Protein) Human Granulysin (GNLY) Protein |
|
20-abx653629 |
Abbexa |
-
EUR 523.00
-
EUR 244.00
-
EUR 1497.00
-
EUR 606.00
-
EUR 384.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
) GNLY Recombinant Protein (Human) |
|
RP013579 |
ABM |
100 ug |
Ask for price |
 Protein) Granulysin (GNLY) Protein |
|
20-abx262124 |
Abbexa |
-
EUR 328.00
-
EUR 5089.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
 GNLY Granulysin Human Recombinant Protein |
|
PROTP22749 |
BosterBio |
Regular: 10ug |
EUR 317 |
|
Description: GNLY Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 159 amino acids and fused to a double His Tag (N+C terminus) and having a total molecular mass of 18.1 kDa.;The GNLY is purified by proprietary chromatographic techniques. |
 GNLY Antibody |
|
43674-100ul |
SAB |
100ul |
EUR 252 |
 GNLY siRNA |
|
20-abx918218 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-GNLY |
|
YF-PA17076 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to GNLY |
 Human GNLY shRNA Plasmid |
|
20-abx957198 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Antibody) Granulysin (GNLY) Antibody |
|
abx027191-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Granulysin (GNLY) Antibody |
|
abx027191-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Granulysin (GNLY) Antibody |
|
20-abx176697 |
Abbexa |
|
|
|
|
Granulysin (GNLY) Antibody |
|
20-abx172666 |
Abbexa |
|
|
|
|
 GNLY Conjugated Antibody |
|
C43674 |
SAB |
100ul |
EUR 397 |
 GNLY cloning plasmid |
|
CSB-CL009627HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 438
- Sequence: atggctacctgggccctcctgctccttgcagccatgctcctgggcaacccaggtctggtcttctctcgtctgagccctgagtactacgacctggcaagagcccacctgcgtgatgaggagaaatcctgcccgtgcctggcccaggagggcccccagggtgacctgttgaccaaaac
- Show more
|
|
Description: A cloning plasmid for the GNLY gene. |
 GNLY Polyclonal Antibody |
|
ABP58659-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human GNLY protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of GNLY from Human. This GNLY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNLY protein |
GNLY Polyclonal Antibody |
|
ABP58659-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human GNLY protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of GNLY from Human. This GNLY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNLY protein |
GNLY Polyclonal Antibody |
|
ABP58659-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human GNLY protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of GNLY from Human. This GNLY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNLY protein |
GNLY Polyclonal Antibody |
|
ES11035-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against GNLY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GNLY Polyclonal Antibody |
|
ES11035-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against GNLY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 Anti-GNLY antibody |
|
STJ192193 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to GNLY |
) Anti-GNLY (2A6) |
|
YF-MA17387 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to GNLY |
 Human granulysin,GNLY ELISA Kit |
|
201-12-0355 |
SunredBio |
96 tests |
EUR 440 |
- This granulysin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 CLIA Kit) Human Granulysin (GNLY) CLIA Kit |
|
abx197066-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Granulysin (GNLY) ELISA Kit |
|
20-abx151728 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Granulysin (GNLY) ELISA Kit |
|
abx250848-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
 Human GNLY/ Granulysin ELISA Kit |
|
E1028Hu |
Sunlong |
1 Kit |
EUR 571 |
 ELISA Kit) Human GNLY(Granulysin) ELISA Kit |
|
EH0156 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.234-15 ng/ml
- Uniprot ID: P22749
- Alias: GNLY(Granulysin)
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.141 ng/ml |
 Human granulysin, GNLY ELISA Kit |
|
CSB-E09936h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human granulysin, GNLY in samples from serum, plasma, cell culture supernates, tissue homogenates, urine. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human granulysin, GNLY ELISA Kit |
|
1-CSB-E09936h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human granulysin, GNLY in samples from serum, plasma, cell culture supernates, tissue homogenates, urine. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Granulysin (GNLY) ELISA Kit |
|
abx571955-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Granulysin (GNLY) CLIA Kit |
|
20-abx492830 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
 (pORF)) GNLY ORF Vector (Human) (pORF) |
|
ORF004527 |
ABM |
1.0 ug DNA |
EUR 95 |
) Human Granulysin ELISA Kit (GNLY) |
|
RK01482 |
Abclonal |
96 Tests |
EUR 521 |
Human Granulysin (GNLY) ELISA Kit |
|
SEB517Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Granulysin (GNLY) ELISA Kit |
|
SEB517Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Granulysin (GNLY) ELISA Kit |
|
SEB517Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Granulysin (GNLY) ELISA Kit |
|
SEB517Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Granulysin (GNLY) ELISA Kit |
|
4-SEB517Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Granulysin elisa. Alternative names of the recognized antigen: NKG5
- LAG-2
- TLA519
- T-Lymphocyte Activation Gene 519
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granulysin (GNLY) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
 (OKAN05019)) GNLY ELISA Kit (Human) (OKAN05019) |
|
OKAN05019 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
|
Description: Description of target: The product of this gene is a member of the saposin-like protein (SAPLIP) family and is located in the cytotoxic granules of T cells, which are released upon antigen stimulation. This protein is present in cytotoxic granules of cytotoxic T lymphocytes and natural killer cells, and it has antimicrobial activity against M. tuberculosis and other organisms. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08 ng/mL |
 (OKBB01536)) GNLY ELISA Kit (Human) (OKBB01536) |
|
OKBB01536 |
Aviva Systems Biology |
96 Wells |
EUR 570 |
|
Description: Description of target: Granulysin is a substance released by cytotoxic T cells(CD8) when they are attached to infected body cells. The product of this gene is a member of the saposin-like protein(SAPLIP) family. It is mapped to 2p11.2. Granulysin functions to create holes in the target cell membrane and destroy it. It is able to induce apoptosis in target cells and also has antimicrobial action. This gene is expressed in cytolytic granules with perforin, a pore forming protein, and granzymes that are also involved in cytolysis. In addition to it, Granulysin is broadly antimicrobial, killing microbes that cause, for example, tuberculosis and malaria, and can destroy some tumors. A series of peptides generated from the amino acid sequence of Granulysin are potential antibiotics. It has been found that secretory Granulysin is a key molecule responsible for the disseminated keratinocyte death in SJS/TEN.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
 (OKCD07459)) GNLY ELISA Kit (Human) (OKCD07459) |
|
OKCD07459 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
|
Description: Description of target: The product of this gene is a member of the saposin-like protein (SAPLIP) family and is located in the cytotoxic granules of T cells, which are released upon antigen stimulation. This protein is present in cytotoxic granules of cytotoxic T lymphocytes and natural killer cells, and it has antimicrobial activity against M. tuberculosis and other organisms. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.08ng/mL |
 (pPB-C-His)) GNLY Protein Vector (Human) (pPB-C-His) |
|
PV018105 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) GNLY Protein Vector (Human) (pPB-N-His) |
|
PV018106 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) GNLY Protein Vector (Human) (pPM-C-HA) |
|
PV018107 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) GNLY Protein Vector (Human) (pPM-C-His) |
|
PV018108 |
ABM |
500 ng |
EUR 329 |
 Recombinant Human GNLY Protein, His, E.coli-10ug |
|
QP12021-10ug |
EnQuireBio |
10ug |
EUR 201 |
 Recombinant Human GNLY Protein, His, E.coli-1mg |
|
QP12021-1mg |
EnQuireBio |
1mg |
EUR 4153 |
 Recombinant Human GNLY Protein, His, E.coli-2ug |
|
QP12021-2ug |
EnQuireBio |
2ug |
EUR 155 |
) CLIA kit for Human GNLY (Granulysin) |
|
E-CL-H1038 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's GNLY CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human GNLY . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
|
Description: A sandwich CLIA kit for quantitative measurement of Human GNLY (Granulysin) in samples from Serum, Plasma, Cell supernatant |
) ELISA kit for Human GNLY (Granulysin) |
|
E-EL-H1618 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's GNLY ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GNLY. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
|
Description: A sandwich ELISA kit for quantitative measurement of Human GNLY (Granulysin) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human GNLY (Granulysin) |
|
ELK2059 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granulysin (GNLY). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granulysin (GNLY
- Show more
|
|
Description: A sandwich ELISA kit for detection of Granulysin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
) GNLY sgRNA CRISPR Lentivector set (Human) |
|
K0878801 |
ABM |
3 x 1.0 ug |
EUR 339 |
 ELISA Kit) Chicken Granulysin (GNLY) ELISA Kit |
|
abx354664-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Monkey Granulysin (GNLY) ELISA Kit |
|
abx354943-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Pig Granulysin (GNLY) ELISA Kit |
|
abx355092-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Rabbit Granulysin (GNLY) ELISA Kit |
|
abx355341-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 (Target 1)) GNLY sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0878802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) GNLY sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0878803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) GNLY sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0878804 |
ABM |
1.0 ug DNA |
EUR 154 |
 : 96 Wells (OKEH02758)) GNLY ELISA Kit (Human) : 96 Wells (OKEH02758) |
|
OKEH02758 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: The product of this gene is a member of the saposin-like protein (SAPLIP) family and is located in the cytotoxic granules of T cells, which are released upon antigen stimulation. This protein is present in cytotoxic granules of cytotoxic T lymphocytes and natural killer cells, and it has antimicrobial activity against M. tuberculosis and other organisms. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL |
 GNLY 3'UTR GFP Stable Cell Line |
|
TU059013 |
ABM |
1.0 ml |
EUR 1394 |
 GNLY 3'UTR Luciferase Stable Cell Line |
|
TU009013 |
ABM |
1.0 ml |
EUR 1394 |
) GNLY sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
|
K0878805 |
ABM |
3 x 1.0 ug |
EUR 376 |
 (Target 1)) GNLY sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
|
K0878806 |
ABM |
1.0 ug DNA |
EUR 167 |
 (Target 2)) GNLY sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
|
K0878807 |
ABM |
1.0 ug DNA |
EUR 167 |
 (Target 3)) GNLY sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
|
K0878808 |
ABM |
1.0 ug DNA |
EUR 167 |
 Protein) Human Translocator Protein (TSPO) Protein |
|
20-abx165906 |
Abbexa |
-
EUR 676.00
-
EUR 272.00
-
EUR 2068.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 Protein) Human Kell Protein (KEL) Protein |
|
20-abx168735 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 Protein) Human Prion Protein (PRNP) Protein |
|
20-abx068667 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2110.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 Protein) Human Protein C (PROC) Protein |
|
20-abx068731 |
Abbexa |
-
EUR 759.00
-
EUR 300.00
-
EUR 2388.00
-
EUR 913.00
-
EUR 537.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
 Protein) Human Protein S (PROS) Protein |
|
20-abx068765 |
Abbexa |
-
EUR 495.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 578.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Protein S (PROS) Protein |
|
20-abx068766 |
Abbexa |
-
EUR 495.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 578.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Human Protein S (PROS) Protein |
|
abx670077-50ug |
Abbexa |
50 ug |
EUR 300 |
|
|
 Protein) Human Protein Z (PROZ) Protein |
|
20-abx654876 |
Abbexa |
-
EUR 620.00
-
EUR 272.00
-
EUR 1859.00
-
EUR 732.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
 BAD Protein Human Recombinant Protein |
|
PROTQ92934 |
BosterBio |
Regular: 5ug |
EUR 479 |
|
Description: Bcl2 antagonist of cell death (BAD) Human Recombinant full length protein expressed in E.coli, shows a 51 kDa band on SDS-PAGE(Icluding GST tag). ;The BAD protein is purified by proprietary chromatographic techniques. |
 PHF11 Protein Human Recombinant Protein |
|
PROTQ9UIL8 |
BosterBio |
Regular: 20ug |
EUR 317 |
|
Description: PHF11 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 351 amino acids (1-331 a.a.) and having a molecular mass of 39.7kDa.;PHF11 is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
 p53 Protein Human Recombinant Protein |
|
PROTP04637-1 |
BosterBio |
Regular: 5ug |
EUR 479 |
|
Description: p53 Human Recombinant full length produced in E.Coli is a non-glycosylated, polypeptide chain having a total Mw of 81kDa. p53 Human Recombinant is fused to GST tag and purified by proprietary chromatographic techniques. |
 Human Albumin protein |
|
30C-CH0925 |
Fitzgerald |
25 mg |
EUR 184 |
|
Description: Highly purified Human Albumin protein |
 Human IgA1 protein |
|
30C-CP7034 |
Fitzgerald |
1 mg |
EUR 213 |
|
Description: Purified Human IgA1 protein |
 Human IgA2 protein |
|
30C-CP8034 |
Fitzgerald |
1 mg |
EUR 247 |
|
Description: Purified Human IgA2 protein |
Human Albumin protein |
|
30R-AA008 |
Fitzgerald |
10 mg |
EUR 984 |
|
Description: Highly purified Human Albumin protein, immunogen grade (>99% pure) |
Human Albumin protein |
|
30R-AH076 |
Fitzgerald |
10 mg |
EUR 241 |
|
Description: Highly purified Human Albumin protein |
 Human AVP Protein |
|
30-1960 |
Fitzgerald |
50 ug |
EUR 259 |
|
Description: Recombinant Human Vasopressin-neurophysin 2-copeptin(AVP) |
 Human IgG4 protein |
|
31-1009 |
Fitzgerald |
100 ug |
EUR 289 |
|
Description: Purified Normal Human plasma IgG4 protein |
 Human IgA protein |
|
31-AH05 |
Fitzgerald |
5 mg |
EUR 365 |
|
Description: Purified Human IgA protein |
 Human IgM protein |
|
31-AH30 |
Fitzgerald |
5 mg |
EUR 470 |
|
Description: Purified Human IgM protein |
 Human IgE protein |
|
31-AI01 |
Fitzgerald |
100 ug |
EUR 505 |
|
Description: Purified Human IgE protein |
 Human IgG protein |
|
31-AI06 |
Fitzgerald |
10 mg |
EUR 156 |
|
Description: Purified Human IgG protein |
 Human IgG1 protein |
|
31-AI17 |
Fitzgerald |
1 mg |
EUR 136 |
|
Description: Purified Human IgG1 protein |
 Human IgG2 protein |
|
31-AI18 |
Fitzgerald |
5 mg |
EUR 367 |
|
Description: Purified Human IgG2 protein |
 Human IgG3 protein |
|
31-AI19 |
Fitzgerald |
1 mg |
EUR 408 |
|
Description: Purified native Human IgG3 protein |
Human IgM protein |
|
31-AI35 |
Fitzgerald |
10 mg |
EUR 365 |
|
Description: Purified Human IgM protein |
Human IgA protein |
|
31C-CH0922 |
Fitzgerald |
1 mg |
EUR 377 |
|
Description: Purified Human IgA protein |
Human IgA protein |
|
31R-1011 |
Fitzgerald |
1 mg |
EUR 171 |
|
Description: Purified Human IgA protein |
Human IgM protein |
|
31R-1015 |
Fitzgerald |
1 mg |
EUR 177 |
|
Description: Purified Human IgM protein |
Human IgA protein |
|
31R-1035 |
Fitzgerald |
1 mg |
EUR 177 |
|
Description: Purified Human IgA protein for use as a control or blocking reagent |
Human IgG protein |
|
31R-1057 |
Fitzgerald |
10 mg |
EUR 257 |
|
Description: Purified native IgG protein |
Human IgG3 protein |
|
31R-1058 |
Fitzgerald |
10 mg |
EUR 1899 |
|
Description: Purified native IgG3 protein |
Human IgG3 protein |
|
31R-1058L |
Fitzgerald |
10 mg |
EUR 1899 |
|
Description: Native Human IgG3 protein |
Human IgA protein |
|
31R-AI001 |
Fitzgerald |
10 mg |
EUR 560 |
|
Description: Purified Human IgA protein |
Human IgG protein |
|
31R-AI034 |
Fitzgerald |
10 mg |
EUR 133 |
|
Description: Purified Human IgG protein |
Human IgM protein |
|
31R-AI037 |
Fitzgerald |
10 mg |
EUR 2552 |
|
Description: Purified Human IgM protein |
) Rad51 Protein (Human) |
|
10-001 |
Sceti |
20ug |
EUR 479 |
|
Description: The Rad51 Protein (Human) is available in Europe and for worldwide shipping via Gentaur. |
Rad51 Protein (Human) |
|
10-002 |
Sceti |
100ug |
EUR 1184 |
|
Description: The Rad51 Protein (Human) is available in Europe and for worldwide shipping via Gentaur. |
) Rad52 Protein (Human) |
|
10-003 |
Sceti |
20ug |
EUR 479 |
|
Description: The Rad52 Protein (Human) is available in Europe and for worldwide shipping via Gentaur. |
Rad52 Protein (Human) |
|
10-004 |
Sceti |
100ug |
EUR 1184 |
|
Description: The Rad52 Protein (Human) is available in Europe and for worldwide shipping via Gentaur. |
 Human DIABLO Protein |
|
abx060001-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human C14orf166 Protein |
|
abx060002-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human S100PBP Protein |
|
abx060003-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human SAA4 Protein |
|
abx060004-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human SUMO2 Protein |
|
abx060006-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human ATOX1 Protein |
|
abx060007-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human PARK7 Protein |
|
abx060008-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human PRDX1 Protein |
|
abx060010-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human CBX3 Protein |
|
abx060011-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human HSD17B10 Protein |
|
abx060012-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human PCMT1 Protein |
|
abx060015-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human ANP32A Protein |
|
abx060016-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human ALDOA Protein |
|
abx060017-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human UBE2E3 Protein |
|
abx060018-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human MLP3B Protein |
|
abx060019-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human PTGDS2 Protein |
|
abx060021-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human CKS1B Protein |
|
abx060022-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human AKAP7 Protein |
|
20-abx060023 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Human AK1 Protein |
|
20-abx060024 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Human SP17 Protein |
|
abx060025-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human CFL1 Protein |
|
abx060026-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human CLIC2 Protein |
|
abx060027-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human ANXA3 Protein |
|
abx060028-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human RAP2B Protein |
|
abx060029-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human ISG20 Protein |
|
abx060032-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human SNRPF Protein |
|
abx060033-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human KAAG1 Protein |
|
abx060034-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human HMG14 Protein |
|
abx060035-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human AK1C1 Protein |
|
abx060037-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human ANX1 Protein |
|
abx060038-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 Human SAA1 Protein |
|
abx060040-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
Amongst them, 1 affected person changed into a extreme case throughout the course of the illness, and 1 affected person confirmed an inclination to change into extreme case. It was discovered that 10 sufferers with out extreme conversion had a median blood Na+ of (138.3±1.3) mmol/L at admission, and the bottom blood Na+ throughout the course of illness was (135.9±3.1) mmol/L. Nonetheless, 2 sufferers who turned extreme and had an inclination to change into extreme illness (Na+ ranges at admission had been 140.Zero mmol/L and 138.Zero mmol/L, respectively) skilled hyponatremia throughout the course of the illness (the bottom blood Na+ ranges had been 129.Zero mmol/L and 122.Zero mmol/L).
ELISA Kit)
