Spleen proteomics data from high fat diet fed mice

The composition of the weight-reduction plan impacts many processes within the physique, together with physique weight and endocrine system. Now we have beforehand proven that dietary fats additionally impacts the immune system. Mice fed excessive fats weight-reduction plan wealthy in polyunsaturated fatty acids survive S. aureus an infection to a a lot higher extent than mice fed excessive fats weight-reduction plan wealthy in saturated fatty acids. Right here we current information concerning the dietary results on protein expression in spleen from mice fed three totally different diets, I) low fats/chow weight-reduction plan (LFD, n = 4), II) excessive fats weight-reduction plan wealthy in saturated fatty acids (HFD-S, n = 4) and III) excessive fats weight-reduction plan wealthy in polyunsaturated fatty acids (HFD-P, n = 4).

We carried out mass spectrophotometry based mostly quantitative proteomics evaluation of remoted spleen by implementing the isobaric tags for relative and absolute quantification (iTRAQ) method. Mass spectrometry information had been analyzed utilizing Proteome Discoverer 2.Four software program utilizing the search engine mascot towards Mus musculus in SwissProt. 924 proteins are recognized in all units (n = 4) for various dietary results taken for statistical evaluation utilizing Qlucore Omics Explorer software program. Solely 20 proteins had been discovered to be differentially expressed with a cut-off worth of false discovery price < 0.1 (q-value) when evaluating HFD-S and HFD-P however no differentially expressed proteins had been discovered when LFD was in contrast with HFD-P or HFD-S. The recognized proteins and statistical evaluation evaluating HFD-S and HFD-P diets can be found as a supplementary file S1. We recognized a subset of proteins that confirmed an inverse expression sample between two excessive fats diets. These differentially expressed proteins had been additional categorised by gene ontology for his or her position in organic processes and molecular features. Mass spectrometry uncooked information are additionally out there by way of ProteomeXchange with identifier PXD020365.

Prime-down mass spectrometry (MS)-based proteomics permits a complete evaluation of proteoforms with molecular specificity to attain a proteome-wide understanding of protein features. Nonetheless, the shortage of a common software program for top-down proteomics is changing into more and more acknowledged as a significant barrier particularly for newcomers. Right here we develop MASH Explorer, a common, complete, and user-friendly software program surroundings for top-down proteomics. MASH Explorer integrates a number of spectral deconvolution and database looking out algorithms right into a single, common platform which might course of top-down proteomics information from varied vendor codecs, for the primary time. It addresses the pressing want within the quickly rising top-down proteomics neighborhood and is freely out there to all customers worldwide. With the vital want and large help from the neighborhood, we envision this MASH Explorer software program package deal will play an integral position in advancing top-down proteomics to understand its full potential for biomedical analysis.

Theoretical minimal RNA rings mimick molecular evolution earlier than tRNA-mediated translation: codon-amino acid affinities improve from early to late RNA rings

Nucleotide affinities for noncovalent interactions with amino acids produce associations between mRNAs and cognate peptides, doubtlessly regulating ribosomal translation. Correlations between nucleotide affinities and residue hydrophobicity are explored for 25 theoretical minimal RNA rings, 22 nucleotide-long RNAs designed in silico to code for every amino acid as soon as after three translation rounds, and forming stem-loop hairpins. This design presumably mimicks life’s first RNAs. RNA rings resemble consensual tRNAs, suggesting proto-tRNA operate, predicted anticodon and cognate amino acid. The 25 RNA rings and their presumed evolutionary order, deduced from the genetic code integration order of the amino acid cognate to their predicted anticodon, produces noteworthy associations with a number of historical properties of the cell’s translational equipment. Right here we use this method to discover the evolution of codon affinity-residue hydrophobicity correlations, assuming these replicate pre-tRNA and pre-ribosomal translations.

This speculation expects that correlations lower with genetic code inclusion orders of RNA ring cognates. RNA ring associations between nucleotide affinities and residue hydrophobicities resemble these from fashionable pure genes/proteins. Affiliation strengths lower with genetic code inclusion ranks of proto-tRNA cognate amino acids. In silico design of minimal RNA rings did not account for affinities between RNA and peptides coded by these RNAs. But, interactions between RNA rings and translated cognate peptides resemble fashionable pure genes.

This property is strongest for historical RNA rings, weakest for current RNA rings, spanning a interval throughout which fashionable tRNA- and ribosome-based translation presumably advanced. Outcomes point out that translation missing tRNA-like adaptors based mostly on codon-amino acid affinities and the genetic code pre-existed tRNA-mediated translation. Theoretical minimal RNA rings seem legitimate prebiotic peptide-RNA world fashions for the transition between pre-tRNA- and tRNA-mediated translations.

Human Granulysin (GNLY) ELISA Kit
RD-GNLY-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Granulysin (GNLY) ELISA Kit
RD-GNLY-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Granulysin (GNLY) Protein
20-abx653629	Abbexa	EUR 523.00 EUR 244.00 EUR 1497.00 EUR 606.00 EUR 384.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

GNLY Recombinant Protein (Human)
RP013579	ABM	100 ug	Ask for price

Granulysin (GNLY) Protein
20-abx262124	Abbexa	EUR 328.00 EUR 5089.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

GNLY Granulysin Human Recombinant Protein
PROTP22749	BosterBio	Regular: 10ug	EUR 317
Description: GNLY Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 159 amino acids and fused to a double His Tag (N+C terminus) and having a total molecular mass of 18.1 kDa.;The GNLY is purified by proprietary chromatographic techniques.

GNLY Antibody
43674-100ul	SAB	100ul	EUR 252

GNLY siRNA
20-abx918218	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-GNLY
YF-PA17076	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to GNLY

Human GNLY ELISA Kit
ELA-E1517h	Lifescience Market	96 Tests	EUR 824

GNLY ELISA KIT|Human
EF000128	Lifescience Market	96 Tests	EUR 689

Human GNLY shRNA Plasmid
20-abx957198	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Granulysin (GNLY) Antibody
abx027191-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Granulysin (GNLY) Antibody
abx027191-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Granulysin (GNLY) Antibody
20-abx176697	Abbexa	EUR 1149.00 EUR 565.00	1 mg 200 ug
Please enquire.

Granulysin (GNLY) Antibody
20-abx172666	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

GNLY Conjugated Antibody
C43674	SAB	100ul	EUR 397

GNLY cloning plasmid
CSB-CL009627HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 438 Sequence: atggctacctgggccctcctgctccttgcagccatgctcctgggcaacccaggtctggtcttctctcgtctgagccctgagtactacgacctggcaagagcccacctgcgtgatgaggagaaatcctgcccgtgcctggcccaggagggcccccagggtgacctgttgaccaaaac Show more
Description: A cloning plasmid for the GNLY gene.

GNLY Polyclonal Antibody
ABP58659-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human GNLY protein Applications tips:
Description: A polyclonal antibody for detection of GNLY from Human. This GNLY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNLY protein

GNLY Polyclonal Antibody
ABP58659-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human GNLY protein Applications tips:
Description: A polyclonal antibody for detection of GNLY from Human. This GNLY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNLY protein

GNLY Polyclonal Antibody
ABP58659-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human GNLY protein Applications tips:
Description: A polyclonal antibody for detection of GNLY from Human. This GNLY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNLY protein

GNLY Polyclonal Antibody
ES11035-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against GNLY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GNLY Polyclonal Antibody
ES11035-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against GNLY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Bovine granulysin,GNLY
QY-E60016	Qayee Biotechnology	96T	EUR 426

Anti-GNLY antibody
STJ192193	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to GNLY

Anti-GNLY (2A6)
YF-MA17387	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to GNLY

Human granulysin,GNLY ELISA Kit
201-12-0355	SunredBio	96 tests	EUR 440
This granulysin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Granulysin (GNLY) CLIA Kit
abx197066-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Granulysin (GNLY) ELISA Kit
20-abx151728	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Granulysin (GNLY) ELISA Kit
abx250848-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human GNLY/ Granulysin ELISA Kit
E1028Hu	Sunlong	1 Kit	EUR 571

Human GNLY(Granulysin) ELISA Kit
EH0156	FN Test	96T	EUR 524.1
Detection range: 0.234-15 ng/ml Uniprot ID: P22749 Alias: GNLY(Granulysin)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.141 ng/ml

Human Granulysin, GNLY ELISA KIT
ELI-05002h	Lifescience Market	96 Tests	EUR 824

Human granulysin, GNLY ELISA Kit
CSB-E09936h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human granulysin, GNLY in samples from serum, plasma, cell culture supernates, tissue homogenates, urine. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human granulysin, GNLY ELISA Kit
1-CSB-E09936h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human granulysin, GNLY in samples from serum, plasma, cell culture supernates, tissue homogenates, urine. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Granulysin (GNLY) ELISA Kit
abx571955-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Granulysin (GNLY) CLIA Kit
20-abx492830	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human granulysin(GNLY)ELISA Kit
GA-E0371HM-48T	GenAsia Biotech	48T	EUR 289

Human granulysin(GNLY)ELISA Kit
GA-E0371HM-96T	GenAsia Biotech	96T	EUR 466

GNLY ORF Vector (Human) (pORF)
ORF004527	ABM	1.0 ug DNA	EUR 95

Human granulysin(GNLY)ELISA Kit
QY-E02489	Qayee Biotechnology	96T	EUR 361

Human Granulysin ELISA Kit (GNLY)
RK01482	Abclonal	96 Tests	EUR 521

Human Granulysin (GNLY) ELISA Kit
SEB517Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granulysin (GNLY) ELISA Kit
SEB517Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granulysin (GNLY) ELISA Kit
SEB517Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granulysin (GNLY) ELISA Kit
SEB517Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granulysin (GNLY) ELISA Kit
4-SEB517Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Granulysin elisa. Alternative names of the recognized antigen: NKG5 LAG-2 TLA519 T-Lymphocyte Activation Gene 519
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granulysin (GNLY) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

GNLY ELISA Kit (Human) (OKAN05019)
OKAN05019	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: The product of this gene is a member of the saposin-like protein (SAPLIP) family and is located in the cytotoxic granules of T cells, which are released upon antigen stimulation. This protein is present in cytotoxic granules of cytotoxic T lymphocytes and natural killer cells, and it has antimicrobial activity against M. tuberculosis and other organisms. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08 ng/mL

GNLY ELISA Kit (Human) (OKBB01536)
OKBB01536	Aviva Systems Biology	96 Wells	EUR 570
Description: Description of target: Granulysin is a substance released by cytotoxic T cells(CD8) when they are attached to infected body cells. The product of this gene is a member of the saposin-like protein(SAPLIP) family. It is mapped to 2p11.2. Granulysin functions to create holes in the target cell membrane and destroy it. It is able to induce apoptosis in target cells and also has antimicrobial action. This gene is expressed in cytolytic granules with perforin, a pore forming protein, and granzymes that are also involved in cytolysis. In addition to it, Granulysin is broadly antimicrobial, killing microbes that cause, for example, tuberculosis and malaria, and can destroy some tumors. A series of peptides generated from the amino acid sequence of Granulysin are potential antibiotics. It has been found that secretory Granulysin is a key molecule responsible for the disseminated keratinocyte death in SJS/TEN.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

GNLY ELISA Kit (Human) (OKCD07459)
OKCD07459	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: The product of this gene is a member of the saposin-like protein (SAPLIP) family and is located in the cytotoxic granules of T cells, which are released upon antigen stimulation. This protein is present in cytotoxic granules of cytotoxic T lymphocytes and natural killer cells, and it has antimicrobial activity against M. tuberculosis and other organisms. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.08ng/mL

GNLY Protein Vector (Human) (pPB-C-His)
PV018105	ABM	500 ng	EUR 329

GNLY Protein Vector (Human) (pPB-N-His)
PV018106	ABM	500 ng	EUR 329

GNLY Protein Vector (Human) (pPM-C-HA)
PV018107	ABM	500 ng	EUR 329

GNLY Protein Vector (Human) (pPM-C-His)
PV018108	ABM	500 ng	EUR 329

Recombinant Human GNLY Protein, His, E.coli-10ug
QP12021-10ug	EnQuireBio	10ug	EUR 201

Recombinant Human GNLY Protein, His, E.coli-1mg
QP12021-1mg	EnQuireBio	1mg	EUR 4153

Recombinant Human GNLY Protein, His, E.coli-2ug
QP12021-2ug	EnQuireBio	2ug	EUR 155

CLIA kit for Human GNLY (Granulysin)
E-CL-H1038	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's GNLY CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human GNLY . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human GNLY (Granulysin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human GNLY (Granulysin)
E-EL-H1618	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's GNLY ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GNLY. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GNLY (Granulysin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human GNLY (Granulysin)
ELK2059	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granulysin (GNLY). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granulysin (GNLY Show more
Description: A sandwich ELISA kit for detection of Granulysin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

GNLY sgRNA CRISPR Lentivector set (Human)
K0878801	ABM	3 x 1.0 ug	EUR 339

Chicken Granulysin (GNLY) ELISA Kit
abx354664-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Granulysin (GNLY) ELISA Kit
abx354943-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Granulysin (GNLY) ELISA Kit
abx355092-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Granulysin (GNLY) ELISA Kit
abx355341-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Bovine granulysin,GNLY ELISA Kit
QY-E60039	Qayee Biotechnology	96T	EUR 426

GNLY sgRNA CRISPR Lentivector (Human) (Target 1)
K0878802	ABM	1.0 ug DNA	EUR 154

GNLY sgRNA CRISPR Lentivector (Human) (Target 2)
K0878803	ABM	1.0 ug DNA	EUR 154

GNLY sgRNA CRISPR Lentivector (Human) (Target 3)
K0878804	ABM	1.0 ug DNA	EUR 154

GNLY ELISA Kit (Human) : 96 Wells (OKEH02758)
OKEH02758	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: The product of this gene is a member of the saposin-like protein (SAPLIP) family and is located in the cytotoxic granules of T cells, which are released upon antigen stimulation. This protein is present in cytotoxic granules of cytotoxic T lymphocytes and natural killer cells, and it has antimicrobial activity against M. tuberculosis and other organisms. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

GNLY 3'UTR GFP Stable Cell Line
TU059013	ABM	1.0 ml	EUR 1394

GNLY 3'UTR Luciferase Stable Cell Line
TU009013	ABM	1.0 ml	EUR 1394

GNLY sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0878805	ABM	3 x 1.0 ug	EUR 376

GNLY sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0878806	ABM	1.0 ug DNA	EUR 167

GNLY sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0878807	ABM	1.0 ug DNA	EUR 167

GNLY sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0878808	ABM	1.0 ug DNA	EUR 167

Human Translocator Protein (TSPO) Protein
20-abx165906	Abbexa	EUR 676.00 EUR 272.00 EUR 2068.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Kell Protein (KEL) Protein
20-abx168735	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Prion Protein (PRNP) Protein
20-abx068667	Abbexa	EUR 690.00 EUR 286.00 EUR 2110.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Protein C (PROC) Protein
20-abx068731	Abbexa	EUR 759.00 EUR 300.00 EUR 2388.00 EUR 913.00 EUR 537.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Human Protein S (PROS) Protein
20-abx068765	Abbexa	EUR 495.00 EUR 244.00 EUR 1414.00 EUR 578.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Protein S (PROS) Protein
20-abx068766	Abbexa	EUR 495.00 EUR 244.00 EUR 1414.00 EUR 578.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Human Protein S (PROS) Protein
abx670077-50ug	Abbexa	50 ug	EUR 300
Shipped within 1 week.

Human Protein Z (PROZ) Protein
20-abx654876	Abbexa	EUR 620.00 EUR 272.00 EUR 1859.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

BAD Protein Human Recombinant Protein
PROTQ92934	BosterBio	Regular: 5ug	EUR 479
Description: Bcl2 antagonist of cell death (BAD) Human Recombinant full length protein expressed in E.coli, shows a 51 kDa band on SDS-PAGE(Icluding GST tag). ;The BAD protein is purified by proprietary chromatographic techniques.

PHF11 Protein Human Recombinant Protein
PROTQ9UIL8	BosterBio	Regular: 20ug	EUR 317
Description: PHF11 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 351 amino acids (1-331 a.a.) and having a molecular mass of 39.7kDa.;PHF11 is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

p53 Protein Human Recombinant Protein
PROTP04637-1	BosterBio	Regular: 5ug	EUR 479
Description: p53 Human Recombinant full length produced in E.Coli is a non-glycosylated, polypeptide chain having a total Mw of 81kDa. p53 Human Recombinant is fused to GST tag and purified by proprietary chromatographic techniques.

Human Albumin protein
30C-CH0925	Fitzgerald	25 mg	EUR 184
Description: Highly purified Human Albumin protein

Human IgA1 protein
30C-CP7034	Fitzgerald	1 mg	EUR 213
Description: Purified Human IgA1 protein

Human IgA2 protein
30C-CP8034	Fitzgerald	1 mg	EUR 247
Description: Purified Human IgA2 protein

Human Albumin protein
30R-AA008	Fitzgerald	10 mg	EUR 984
Description: Highly purified Human Albumin protein, immunogen grade (>99% pure)

Human Albumin protein
30R-AH076	Fitzgerald	10 mg	EUR 241
Description: Highly purified Human Albumin protein

Human AVP Protein
30-1960	Fitzgerald	50 ug	EUR 259
Description: Recombinant Human Vasopressin-neurophysin 2-copeptin(AVP)

Human IgG4 protein
31-1009	Fitzgerald	100 ug	EUR 289
Description: Purified Normal Human plasma IgG4 protein

Human IgA protein
31-AH05	Fitzgerald	5 mg	EUR 365
Description: Purified Human IgA protein

Human IgM protein
31-AH30	Fitzgerald	5 mg	EUR 470
Description: Purified Human IgM protein