PP2Acα inhibits PFKFB2-induced glycolysis to promote termination of liver regeneration.PP2Acα inhibits PFKFB2-induced glycolysis to promote termination of liver regeneration.

PP2Acα inhibits PFKFB2-induced glycolysis to promote termination of liver regeneration.

The mechanisms underlying the initiation and proliferation of liver regeneration (LR) has been extensively studied utilizing the partial hepatectomy (PHx) mannequin, whereas little is understood in regards to the termination of LR. PP2Acα (protein phosphatase 2 A catalytic subunit α isoform) is the catalytic subunit of protein phosphatase 2 A (PP2A), accounting for many of intracellular serine/threonine phosphatase exercise. Now we have beforehand noticed that termination of LR delayed in PP2Acα liver-specific knockout (LKO) mice after PHx. In our examine, we used phospho explorer antibody array evaluation to display screen the potential phosphorylation targets of PP2Acα, and PP2Acα had an incredible affect on the hepatic phosphoproteomic signaling within the termination of LR after PHx.

We then examined the phosphorylation adjustments and metabolic perform of 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-2 (PFKFB2), an isoform of the important thing glycolytic enzyme PFKFB, which was considerably regulated by PP2Acα knockout. PP2Acα knockout enhanced glycolysis in vivo and in vitro, whereas adenoviral-mediated RNAi of PFKFB2 reversed the extension of postoperative liver regeneration in KO mice together with the downregulation of glycolysis. Subsequently, we demonstrated that PP2Acα liver-specific knockout regulated the hepatocytes glycolysis through activating PFKFB2, thus enhancing liver regeneration in the course of the termination stage.

The heteronuclear (blended metallic) complexes of Schiff bases have been explored as a part of the coordination and bioinorganic chemistry. 5 novel blended metallic complexes of (E)-2-(butan-2-ylidene) hydrazinecarbothioamide (2-butanone thiosemicarbazone) had been ready and characterised by completely different spectroscopic methods. Molecular docking research had been carried out with three proteins for 2 complexes. The toxicity potential, physicochemical properties and bioactivity scores had been additionally predicted. The complexes had been examined in opposition to three cell traces and in addition evaluated for his or her antibacterial exercise.The blended metallic complexes had been ready in 1:Four molar ratio of metallic salt and ligand. OSIRIS 4.6.1 was used to evaluate the toxicity whereas Molinspiration 2016.03 was used to calculate the bioactivity scores and different physicochemical properties.

Principal Part Evaluation (PCA) was carried out utilizing the Osiris Property Explorer 4.5.1 for outlining and visualizing multidimensional property areas by assigning dimensions to numerical descriptors. Molecular docking research had been carried out with three proteins. The anticancer exercise was examined in opposition to MCF-7, MDA-MB-231, HepG2 and A549 cell traces utilizing MTT assay whereas antibacterial exercise was examined utilizing disc diffusion technique.The melting factors of the complexes had been as excessive as >3500C, indicating excessive thermal stability. exhibited minimal energies in opposition to the chosen proteins.

Metallothionein-2 is related to the amelioration of asthmatic pulmonary perform by acupuncture via protein phosphorylation.

Acupuncture has lengthy been used for bronchial asthma therapy however the underlying mechanism stays unclear. Earlier examine confirmed that metallothionein-2 (MT-2) was considerably decreased in asthmatic lung tissue. Nevertheless, the connection between acupuncture therapy and MT-2 expression throughout bronchial asthma continues to be unknown, and the detailed impact evaluation of MT-2 on phosphorylation in airway easy muscle cells (ASMCs) can also be unclear.The acupuncture impact on pulmonary resistance (RL) was investigated in a rat mannequin of bronchial asthma, and the mRNA and protein ranges of MT-2 in lung tissue had been detected. Major ASMCs had been remoted and handled with MT-2 recombinant protein to review the MT-2 results on ASMC leisure. A Phospho Explorer antibody microarray was utilized to detect protein phosphorylation adjustments related to MT-2-induced ASMC leisure.
Bioinformatic evaluation had been carried out with PANTHER database, DAVID and STRING. Phosphorylation adjustments in key proteins had been confirmed by Western blot.Acupuncture considerably decreased RL at 2-5 min (P < 0.05 vs bronchial asthma) in asthmatic rats. Acupuncture continued to extend MT-2 mRNA expression in lung tissue for as much as 14 days (P < 0.05 vs bronchial asthma). The MT-2 protein expression was considerably decreased within the asthmatic rats (P < 0.05 vs management), whereas MT-2 protein expression was considerably elevated within the asthmatic mannequin group handled with acupuncture (P < 0.05 vs bronchial asthma). Major ASMCs had been efficiently remoted and recombinant MT-2 protein (100, 200, 400 ng/ml) considerably relaxed ASMCs (P < 0.05 vs management). MT-2 induced phosphorylation adjustments in 51 proteins.
Phosphorylation of 14 proteins had been upregulated whereas 37 proteins had been downregulated. PANTHER classification revealed eleven practical teams, and the phosphorylated proteins had been recognized as transferases (27.8 %), calcium-binding proteins (11.1 %), and so forth. DAVID practical classification confirmed that the phosphorylated proteins might be attributed to eight capabilities, together with protein phosphorylation and regulation of GTPase exercise. STRING proteinprotein interplay community evaluation confirmed that Akt1 was one of the vital hubs for the phosphorylated proteins. The phosphorylation adjustments of Akt1 and CaMK2β had been constant in each the Phospho Explorer antibody microarray and Western blot.Acupuncture can considerably ameliorate RL, and the MT-2 mRNA and protein ranges in lung tissue are elevated throughout therapy. MT-2 considerably relaxes ASMCs and induces a sequence of protein phosphorylation. These phosphorylation adjustments, together with Akt1 and CaMK2β, could play vital roles within the therapeutic results of acupuncture on bronchial asthma.
PP2Acα inhibits PFKFB2-induced glycolysis to promote termination of liver regeneration.

ENCORE: A Visualization Device for Perception into Circadian Omics.

Circadian rhythms are 24-hour organic cycles that management each day molecular rhythms in lots of organisms. The mobile parts that fall below the regulation of the clock are sometimes studied via the usage of omics-scale knowledge units gathered over time to find out how circadian regulation impacts mobile physiology. Beforehand, we created the ECHO (Prolonged Circadian Harmonic Oscillator) software to establish rhythms in these knowledge units. Utilizing ECHO, we discovered that circadian oscillations extensively endure a change in amplitude over time and that these amplitude adjustments have a organic perform within the cell. Nevertheless, ECHO doesn’t align gene ontologies with the recognized oscillating genes to offer practical context.

PRRC1 Antibody

1-CSB-PA853460LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRRC1. Recognizes PRRC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PRRC1 antibody

70R-3262 50 ug
EUR 467
Description: Rabbit polyclonal PRRC1 antibody raised against the middle region of PRRC1

PRRC1 siRNA

20-abx904279
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PRRC1 siRNA

20-abx929985
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PRRC1 siRNA

20-abx929986
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PRRC1 Recombinant Protein (Human)

RP024766 100 ug Ask for price

PRRC1 Recombinant Protein (Mouse)

RP164936 100 ug Ask for price

PRRC1 Recombinant Protein (Rat)

RP222398 100 ug Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

PRRC1 Blocking Peptide

33R-9551 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PRRC1 antibody, catalog no. 70R-3262

PRRC1 Antibody (HRP)

20-abx310250
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PRRC1 Antibody (FITC)

20-abx310251
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PRRC1 Antibody (Biotin)

20-abx310252
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PRRC1 cloning plasmid

CSB-CL853460HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1335
  • Sequence: atggaagagagtggaatagagacaacaccacctgggactcctccaccaaatcctgcagggctggctgctactgctatgtcttctacccctgttccattagcggcaaccagttctttttcttctccaaatgtatcctccatggagtccttcccaccactcgcatactctactcctc
  • Show more
Description: A cloning plasmid for the PRRC1 gene.

PRRC1 Polyclonal Antibody

A60434 100 µg
EUR 570.55
Description: reagents widely cited

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

PRRC1 Antibody, HRP conjugated

1-CSB-PA853460LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRRC1. Recognizes PRRC1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PRRC1 Antibody, FITC conjugated

1-CSB-PA853460LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRRC1. Recognizes PRRC1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PRRC1 Antibody, Biotin conjugated

1-CSB-PA853460LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRRC1. Recognizes PRRC1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat PRRC1 shRNA Plasmid

20-abx988505
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PRRC1 shRNA Plasmid

20-abx977917
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PRRC1 shRNA Plasmid

20-abx965120
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

PRRC1 Protein Vector (Rat) (pPB-C-His)

PV296534 500 ng
EUR 603

PRRC1 Protein Vector (Rat) (pPB-N-His)

PV296535 500 ng
EUR 603

PRRC1 Protein Vector (Rat) (pPM-C-HA)

PV296536 500 ng
EUR 603

PRRC1 Protein Vector (Rat) (pPM-C-His)

PV296537 500 ng
EUR 603

PRRC1 Protein Vector (Human) (pPB-C-His)

PV033021 500 ng
EUR 329

PRRC1 Protein Vector (Human) (pPB-N-His)

PV033022 500 ng
EUR 329

PRRC1 Protein Vector (Human) (pPM-C-HA)

PV033023 500 ng
EUR 329

PRRC1 Protein Vector (Human) (pPM-C-His)

PV033024 500 ng
EUR 329

PRRC1 Protein Vector (Mouse) (pPB-C-His)

PV219918 500 ng
EUR 603

PRRC1 Protein Vector (Mouse) (pPB-N-His)

PV219919 500 ng
EUR 603

PRRC1 Protein Vector (Mouse) (pPM-C-HA)

PV219920 500 ng
EUR 603

PRRC1 Protein Vector (Mouse) (pPM-C-His)

PV219921 500 ng
EUR 603

Polyclonal PRRC1 antibody - middle region

APR01140G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRRC1 - middle region. This antibody is tested and proven to work in the following applications:

PRRC1 Polyclonal Antibody, Biotin Conjugated

A60435 100 µg
EUR 570.55
Description: Ask the seller for details

PRRC1 Polyclonal Antibody, FITC Conjugated

A60436 100 µg
EUR 570.55
Description: The best epigenetics products

PRRC1 Polyclonal Antibody, HRP Conjugated

A60437 100 µg
EUR 570.55
Description: kits suitable for this type of research

Prrc1 ORF Vector (Rat) (pORF)

ORF074134 1.0 ug DNA
EUR 506

PRRC1 ORF Vector (Human) (pORF)

ORF008256 1.0 ug DNA
EUR 95

Prrc1 ORF Vector (Mouse) (pORF)

ORF054980 1.0 ug DNA
EUR 506

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

APCDD1 ELISA Kit| chicken Protein APCDD1 ELISA Kit

EF012190 96 Tests
EUR 689

AATF ELISA Kit| chicken Protein AATF ELISA Kit

EF012205 96 Tests
EUR 689

ATP1B4 ELISA Kit| chicken Protein ATP1B4 ELISA Kit

EF012211 96 Tests
EUR 689

CREG1 ELISA Kit| chicken Protein CREG1 ELISA Kit

EF012240 96 Tests
EUR 689

CRBN ELISA Kit| chicken Protein cereblon ELISA Kit

EF012243 96 Tests
EUR 689

CHURC1 ELISA Kit| chicken Protein Churchill ELISA Kit

EF012248 96 Tests
EUR 689

JARID2 ELISA Kit| chicken Protein Jumonji ELISA Kit

EF012359 96 Tests
EUR 689

LZIC ELISA Kit| chicken Protein LZIC ELISA Kit

EF012369 96 Tests
EUR 689

PCLO ELISA Kit| chicken Protein piccolo ELISA Kit

EF012465 96 Tests
EUR 689

RP2 ELISA Kit| chicken Protein XRP2 ELISA Kit

EF012491 96 Tests
EUR 689

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

Chicken FAM214A/ Protein FAM214A ELISA Kit

E0026Ch 1 Kit
EUR 717

Chicken Haptoglobin Related Protein ELISA Kit

ELA-E0201d 96 Tests
EUR 928

Chicken C- Reactive Protein ELISA Kit

ELA-E0829d 96 Tests
EUR 928

Chicken Protein CBFA2T3, CBFA2T3 ELISA KIT

ELI-15966c 96 Tests
EUR 928

Chicken Protein NEF1, NEF1 ELISA KIT

ELI-16454c 96 Tests
EUR 928

Chicken Protein YIPF4, YIPF4 ELISA KIT

ELI-17543c 96 Tests
EUR 928

Chicken Protein FAM122A, FAM122A ELISA KIT

ELI-09567c 96 Tests
EUR 928

Chicken Protein FAM53A, FAM53A ELISA KIT

ELI-09775c 96 Tests
EUR 928

Chicken Protein APCDD1, APCDD1 ELISA KIT

ELI-11681c 96 Tests
EUR 928

Chicken Protein LBH, LBH ELISA KIT

ELI-12449c 96 Tests
EUR 928

Chicken Protein EURL, EURL ELISA KIT

ELI-20563c 96 Tests
EUR 928

Chicken Protein FAM49A, FAM49A ELISA KIT

ELI-20614c 96 Tests
EUR 928

Chicken Protein TENP, TENP ELISA KIT

ELI-23246c 96 Tests
EUR 928

Chicken Protein CASC4, CASC4 ELISA KIT

ELI-23847c 96 Tests
EUR 928

Chicken Brachyury protein, T ELISA KIT

ELI-24138c 96 Tests
EUR 928

Chicken Protein CNPPD1, CNPPD1 ELISA KIT

ELI-24988c 96 Tests
EUR 928

Chicken Protein BTG1, BTG1 ELISA KIT

ELI-25357c 96 Tests
EUR 928

Chicken Protein cereblon, CRBN ELISA KIT

ELI-25557c 96 Tests
EUR 928

Chicken Protein HIRA, HIRA ELISA KIT

ELI-27830c 96 Tests
EUR 928

Chicken Protein LZIC, LZIC ELISA KIT

ELI-27842c 96 Tests
EUR 928

Chicken Protein XRP2, RP2 ELISA KIT

ELI-28791c 96 Tests
EUR 928

Chicken Protein FAM46C, FAM46C ELISA KIT

ELI-30758c 96 Tests
EUR 928

Chicken Cryptic protein, CFC1 ELISA KIT

ELI-05197c 96 Tests
EUR 928

Chicken Protein CREG1, CREG1 ELISA KIT

ELI-26120c 96 Tests
EUR 928

Chicken Protein artemis, DCLRE1C ELISA KIT

ELI-26331c 96 Tests
EUR 928

Chicken Protein FAM133, FAM133 ELISA KIT

ELI-27010c 96 Tests
EUR 928

Chicken Protein DGCR6, DGCR6 ELISA KIT

ELI-08260c 96 Tests
EUR 928

Chicken Protein GTLF3B, GTLF3B ELISA KIT

ELI-08533c 96 Tests
EUR 928

Chicken Protein FAM172A, FAM172A ELISA KIT

ELI-08543c 96 Tests
EUR 928

Chicken Protein FAM76A, FAM76A ELISA KIT

ELI-08565c 96 Tests
EUR 928

Chicken Protein syndesmos, SDOS ELISA KIT

ELI-52380c 96 Tests
EUR 928

Chicken Protein RER1, RER1 ELISA KIT

ELI-42845c 96 Tests
EUR 928

Chicken Protein FAM60A, FAM60A ELISA KIT

ELI-43853c 96 Tests
EUR 928

Chicken Protein piccolo, PCLO ELISA KIT

ELI-45168c 96 Tests
EUR 928

Chicken Protein S (PROS) ELISA Kit

abx355993-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken TU3A Protein (TU3A) ELISA Kit

abx356822-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Protein Z (PROZ) ELISA Kit

abx355765-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Prion Protein (PRNP) ELISA Kit

abx521104-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Chicken Protein FAM210A (FAM210A) ELISA Kit

abx555356-96tests 96 tests
EUR 911
  • Shipped within 1-3 weeks.

Chicken Protein cereblon (CRBN) ELISA Kit

abx516196-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Chicken Protein FAM214A (FAM214A) ELISA Kit

abx517357-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Chicken Protein max (MAX) ELISA Kit

abx512851-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Chicken Protein CYR61 (CYR61) ELISA Kit

abx513097-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Chicken Protein FAM206A, FAM206A ELISA KIT

ELI-32611c 96 Tests
EUR 928

Chicken Protein FAM65B, FAM65B ELISA KIT

ELI-32868c 96 Tests
EUR 928

Chicken Protein FAM195B, FAM195B ELISA KIT

ELI-32934c 96 Tests
EUR 928

Chicken Protein Churchill, CHURC1 ELISA KIT

ELI-33488c 96 Tests
EUR 928

Chicken Protein YIPF3, YIPF3 ELISA KIT

ELI-35242c 96 Tests
EUR 928

Chicken Protein quaking, QKI ELISA KIT

ELI-37936c 96 Tests
EUR 928

Chicken Protein NOV, NOV ELISA KIT

ELI-38132c 96 Tests
EUR 928

Chicken Protein Jumonji, JARID2 ELISA KIT

ELI-38162c 96 Tests
EUR 928

Chicken Protein NEL, NEL ELISA KIT

ELI-39578c 96 Tests
EUR 928

Chicken Protein ATP1B4, ATP1B4 ELISA KIT

ELI-49587c 96 Tests
EUR 928

Chicken Protein AATF, AATF ELISA KIT

ELI-49732c 96 Tests
EUR 928

Chicken Protein Dr1, DR1 ELISA KIT

ELI-36705c 96 Tests
EUR 928

Chicken Protein FAM116A, FAM116A ELISA KIT

ELI-47562c 96 Tests
EUR 928

Chicken Protein FAM48A, FAM48A ELISA KIT

ELI-47764c 96 Tests
EUR 928

Prrc1 sgRNA CRISPR Lentivector set (Mouse)

K4788601 3 x 1.0 ug
EUR 339

Prrc1 sgRNA CRISPR Lentivector set (Rat)

K7241901 3 x 1.0 ug
EUR 339

PRRC1 sgRNA CRISPR Lentivector set (Human)

K1731601 3 x 1.0 ug
EUR 339

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Chicken MMP2 ELISA kit

55R-2037 96 tests
EUR 685
Description: ELISA Kit for detection of MMP2 in the research laboratory

Chicken E2 ELISA kit

55R-2103 96 tests
EUR 739
Description: ELISA Kit for detection of E2 in the research laboratory

Chicken IL17 ELISA kit

55R-2174 96 tests
EUR 766
Description: ELISA Kit for detection of IL17 in the research laboratory

Chicken IgA ELISA Kit

E-30A 1 x 96 well plate
EUR 395
Thus, we created ENCORE (ECHO Native Circadian Ontological Rhythmicity Explorer), a novel visualization software which mixes the disparate databases of Gene Ontologies, proteinprotein interactions, and auxiliary data to uncover the which means of circadianly-regulated genes. This freely-available software performs automated enrichment and creates publication-worthy visualizations which we used to increase previously-gathered knowledge on circadian regulation of physiology from printed omics-scale research in three circadian mannequin organisms: mouse, fruit fly, and Neurospora crassa.

Leave a Reply

Your email address will not be published. Required fields are marked *

You may use these HTML tags and attributes: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <s> <strike> <strong>